" The Big Picture!" by Mr C

Last lessons

1)    Collaborative Treasure Hunt

2)    Wikipedia “aha” reading response

3)    Next class quiz

2)    Defining Population Evolution

3)    Hardy Weinberg formula

Number One

Defining Population Evolution

https://www.boundless.com/biology/textbooks/boundless-biology-textbook/the-evolution-of-populations-19/population-evolution-130/defining-population-evolution-527-11733/

How many definitions about evolution talk about genes?

What exactly is a “gene”

Looking at the above link, record key terms and try to create an example of each.

How do you suppose these “terms” link to key points?

How do these terms link to previous case studies in the class?

Work:

a)   Definitions from board, text and link

b)   Text Question pg 182

Mendel and Darwin

https://www.youtube.com/watch?v=WhFKPaRnTdQ

Number Two

The Hardy Weinberg Formula

https://www.youtube.com/watch?v=xPkOAnK20kw

What must occur for evolution not to occur?

Linking ideas like allele

Plan A: Going from Population Phenotypes to Genotype

Plan B: Going from Genotype to Phenotype

Key tricks to solving questions

1)    In a population and looking at phenotype, always use the number of organisms that do not show the trait. Example, if 80 of 110 plants show dominate trait, calculate the allele frequency. So 110 minus 80 are purebred recessive or “aa”.

2)    When you are given the dominant allele frequency, calculate the recessive allele frequency first. Example the dominant allele frequency is .65. If the whole population is 1 and you subtract .65 from 1, the recessive allele frequency is .35 for the population.

Number Three

Video

https://www.youtube.com/watch?v=oG7ob-MtO8c

Practice

http://study.com/academy/practice/quiz-worksheet-hardy-weinberg-equilibrium-equation.html

Chapter 6

Last lessons

1)    story of Evolution Timeline

2)    Darwin verse Lamarck

3)    Problems with Linneaus, Taxonomy and DNA

2)    Wikipedia “aha” reading response

3)    Next class quiz

4)

Number One

The following evaluation was found in an archeological dig as Vancouver Dump. Your mission is to create an answer key for questions. You will be given open book resources, no online information and one feedback response

Number Two

https://en.wikipedia.org/wiki/Charles_Darwin

Find 5 “Aha” observations.

For example,

“did you know Darwin married his second cousin and was worried that imbreeding may have caused the death of his children. He never read mendel though..

So read the article

Select:

a)   Two aha’s about Darwins personal life and explain why you found these fact interesting

b)   Two aha s that explained more details found in text and notes and explain how these facts helped explain material deeper

c)   One aha within the wiki that made you want to go to a second link within the bio. Explain why

Number Three

Check evaluation answers

Quiz on Chapter 3

Introduction to Chapter 6 and work on structure and function of DNA

Chapter 6

Last lessons

1)    story of Evolution Timeline

2)    Darwin verse Lamarck

3)    Problems with Linneaus, Taxonomy and DNA

2)    The rate of change: punctuated or gradual

3)    Introduction to Taxonomy

Number One

Key points.

1)    A population of finches arrived to the Islands from mainland south America, perhaps Ecuador.

2)    On the initial island there was:

·      Plenty of food

·      Niches to set up territories

·      No natural predators

3)    As the species started to grow, there began a competition of food and space.

4)    Some species born did not have the correct beak to get food and they migrated to another island.

5)    On the new island, those species that survived were those species that had the right beak adaption to get food. ( See definition for adaptive radiation)

6)    Each Island has its own unique climate and habitat, the species that had the best beak to get food on that island became the dominant species on that island.

Wallace discovered the same pattern with islands

https://www.wired.com/2012/08/island-evolution-more-species/

Wallace web page

http://wallacefund.info

Wallace paper to Linneaus society

http://wallacefund.info/content/1858-darwin-wallace-paper

Number Two

http://evolution.about.com/od/macroevolution/a/Gradualism-Vs-Punctuated-Equilibrium.htm

What is adaptive radiation and how can it help explain different rates of change?

Darwin’s Dilemma

http://evolution.about.com/od/Darwin/fl/Darwins-Dilemma.htm

Video to compare

·      https://www.youtube.com/watch?v=SP553wXgXJc

·      https://www.youtube.com/watch?v=qWUqQyVa5ts

·      https://www.youtube.com/watch?v=4eEEWwwezlw

Number Three

a)   Taxonomy came first and did not consider DNA

b)   Evolutionary theories did not know about DNA

c)   Gradual and Punctuated Equilibrium

What is taxonomy and Linneaus’s plan

·      https://www.youtube.com/watch?v=aiC_Z8Za7wc

·      https://www.youtube.com/watch?v=KPtAuojPQVQ

·      https://www.youtube.com/watch?v=F38BmgPcZ_I

What is the difference between a system using kingdoms verses Domains?

Chapter 6: Traits and allele frequency

Chapter 7: Taxonomy

Practice Evolution quizzes

·      http://anthro.palomar.edu/practice/evoquiz2.htm

·      http://highered.mheducation.com/sites/0073031208/student_view0/chapter20/multiple_choice.html

·      https://www.cliffsnotes.com/study-guides/biology/biology/principles-of-evolution/quiz-theory-of-evolution

Last lessons

1)    Darwin’s Dangerous Idea

2)    Performance, feedback and revision

3)    From Aristotle to Now

2)    Darwin verse Lamarck

3)    Problems with Linneaus, Taxonomy and DNA

Number One

a)   theory of “fixity of species” needed to be refuted.

b)   animals classified not by evolution nor DNA

·      Classification of living things: Linnaeus

·      role of fossils: Cuvier

·      Buffon challenges fixity of species

·      Hutton introduces change with time regarding geology

·      Malthus: struggle for existence

·      Lamarck: Acquired characteristics and use and disuse

·      Darwin

·      Mendel

·      Role of DNA and Heredity

·      Role of DNA and evolution

History of Evolutionary Thought

https://en.wikipedia.org/wiki/History_of_evolutionary_thought

Number Two

Evidence and theory for a mechanism of change

http://necsi.edu/projects/evolution/lamarck/intro./lamarck_intro.html

·      https://en.wikipedia.org/wiki/History_of_evolutionary_thought

·      http://www.iep.utm.edu/evolutio/

·      http://sciencenetlinks.com/student-teacher-sheets/lamarck-and-darwin-summary-theories/

·      http://www.majordifferences.com/2013/05/difference-between-darwinism-and.html#.WAaJSHfMz_Q

Key concepts

·      Traits acquired verses being selected

·      Organism adapts verse environment is favouring those who adapt.

·      Use and disuse verse struggle for existence

·      Key issue

·      Neither new about the source but did propose a mechanism for change.

Practice quiz

·      http://anthro.palomar.edu/practice/evoquiz2.htm

·      http://highered.mheducation.com/sites/0073212040/student_view0/chapter17/multiple_choice_quiz.html

·      http://zunal.com/introduction.php?w=54845

Number Three

a)   Taxonomy came first and did not consider DNA

b)   Evolutionary theories did not know about DNA

c)   Gradual and Punctuated Equilibrium

Three paths of Inquiry

a)   How are living things classified (chapter 7)

b)   What is the mechanism for change (chapter 3)

c)   What is the role of DNA in Evolution (Chapter 6)

Chapter 6

Chapter 7

https://en.wikipedia.org/wiki/Molecular_phylogenetics

Hardy and Weinberg (chapter 6)

http://www.phschool.com/science/biology_place/labbench/lab8/quiz.html

What is the function of DNA?

Where is DNA found?

What is the structure of DNA?

What is a nucleotide?

Shat are the 4 bases found in DNA?

What is complementary base pairing?

•     DeoxyriboNucleicAcid

•     provides instructions for

o   the synthesis of enzymes that control cell functioning

o   its own replication (the only molecule known that can replicate itself)

•     found in all cells of all organisms

•     in eukaryotes it is found only in the nucleus

•       two long strands twisted around each other in a shape called a “double helix”

•     when unravelled it looks like a ladder

•     sides of the ladder are alternating sugar and phosphate – the “sugar phosphate backbone”

•     rungs of the ladder arecomplementary pairs of “nitrogenous bases” joined by hydrogen bonds

•     largest humn chromosome has about 250,000,000 base pairs

•     DNA molecule made up of many units (like lego blocks) called nucleotides

•     each nucleotide consists of a phosphate molecule + sugar + nitrogenous base

 
•     4 types of bases in DNA

o   adenine (A)

o   cytosine (C)

o   guanine (G)

o   thymine (T)

•     adenine and thymine complement each other and always pair

•     cytosine and guanine complement each other and always pair

What are enzymes?

•       Each gene consist of a length of DNA that contains instructions (the “code”) for making a specific enzyme.

•       protein molecules that control the chemical reactions in a cell

•       Enzymes are proteins made of long chains of amino acids.

•       there are 20 kinds of amino acids.

An Analogy:

Think of the nitrogenous bases along a single strand of DNA as being letters:

ATGCTCGAATAAATGTGAATTTGA

The letters make words:

ATG   CTC   GAA     TAA   ATG   TGA     ATT   TGA
 

The words make sentences:

<ATG     CTC   GAA   TAA     ATG   TGA   ATT     TGA>
These “sentences” are called genes. Each three letter “word” in the sentence is called a codon, and represents a different amino acid. Enzymes are proteins made of long strings of amino acids. Each “sentence” (gene) is the code for an enzyme made up of amino acids.

What is the function of RNA?

Where is RNA found?

What is the structure of RNA?

what are the 3 kinds of RNA?

How is RNA formed?

How are enzymes assembled?

•     functions as a messenger, carrying instructions from the DNA to the rest of the cell

•     in the nucleus and in the cytoplasmm

•     similar to DNA except:

•     only one strand

•     the base thymine is replced with a base called uracil (U)

1.     messengern RNA (mRNA)

2.    transfer RNA (tRNA)

3.    ribosomal RNA (rRNA)

RNA formed through a process called transcription

1) The hydrogen bonds between complementary bases break.

2) Thedouble helix unravels (becomes untwisted), exposing unpaired bases.

3) New nucleotides, with complementary bases, come and form a new chain along only one strand of the DNA.

4) Chemical bonds form between the sugars and the phosphates of the new nucleotides

•     Every time the cell needs a particular enzyme assembled, a new mRNA molecule is created from the gene on the DNA that “codes for” that enzyme

•     the mRNA goes out into the cytoplasm and finds a ribosome, which is an organelle that assembles proteins

•     the ribosome “reads” the mRNA code and uses it to assemble a chain of amino acids that becomes the required enzyme

What is the process of DNA replication?

1)    The hydrogen bonds between complementary bases break

2)    The double helix unravels (becomes untwisted), exposing unpaired bases

3)    New nucleotides, with complementary bases, come and form hydrogen bonds with the unpaired bases, forming a new chain.

4)     Chemical bonds form between the sugars and phosphates of the new nucleotides.

5)    The result is 2 new strands of DNA, each of which has one strand from the original DNA and one strand that is newly created.

 
Every once in a while, a mistake happens while DNA is duplicating itself, and the new strand will be slightly different than the original strand. These mistakes are called mutations