" The Big Picture!" by Mr C

VSB Science Blog

Archive for the 'Biology Eleven' Category

Bio 11 SS lesson July 11th 2016

Biology 11 Lesson Outline                                      Date July 11 th

 

 

Last lessons Objectives

 

 

1.   History of evolutionary theory

·      Aristotle

·      Fixity of species

·      Cuvier and Buffon

·      Lamarck and Darwin

2.   Insect Dichotomous Key Lab

Gene flow, Gene Pool and Evolution

1.   Evidence for evolution and classification

2.   Charting evolution with graphs

3.   Isolation mechanisms as evidence of how change could occur

Evaluation
Today’s Objectives 1.   Gradualism verses Punctuated Equilibrium

2.   Adaptive radiation form two points of view

3.   Intro to micro: Virus and taxonomy

Topic

Number One

Using Darwin’s ideas to explore rate of change

 

Great Lecture Notes from Columbia University

http://eesc.columbia.edu/courses/v1001/evol.html

 

 

Gradual verse Punctuated Equilibrium

Graphic interpretation

http://eesc.columbia.edu/courses/v1001/gradpunct.html

 

Adaptive radiation

Wiki

https://en.wikipedia.org/wiki/Adaptive_radiation

 

 

Causes for change in rate

https://en.wikipedia.org/wiki/Rate_of_evolution

 

Topic

Number Two

Change and genetics

 

http://science.jrank.org/pages/2612/Evolutionary-Change-Rate.html

 

The new understanding of evolution

 

Gene Pool, Gene flow and evolution

 

Gene drift verses Genetic flow

http://www.shmoop.com/mechanisms-evolution/gene-flow-drift.html

 

Power points

http://slideplayer.com/slide/2378043/

 

http://slideplayer.com/slide/3907372/

 

http://slideplayer.com/slide/3529233/

 

Vocab

·      Gene Pool

·      Gene Flow

·      Genetic Drift

·      Bottleneck affect

·      Gene frequency

 

Three Taxonomy and Virus

 

Key paths to follow

 

Shallow water..simple

https://students.ga.desire2learn.com/d2l/lor/viewer/viewFile.d2lfile/1798/12774/viruses-bacteria12.html

 

 

On tippy toes

https://www.biologycorner.com/APbiology/pathology/virus.html

 

 

Deep water..more complex

http://www.ncbi.nlm.nih.gov/books/NBK8174/

 

Wiki

https://en.wikipedia.org/wiki/Virus

 

 

You are looking for

a)   structure and function

b)   classification

c)    types of reproduction

d)   what is a retrovirus

e)   what is latent and lytic

f)     how are viruses linked to evolution

g)   which came first the virus or a living cell?

 

 

Jenner Videos

https://www.youtube.com/watch?v=f0z7AN9lE3U

 

https://www.youtube.com/watch?v=EQl0W62DCAY

 

 

x
Debrief and new topic  

Find Gap Notes in the Bio 11 Notes

Good review for possible quizzes

New Gap Notes

·

Text Book

 

Class Notes

Chapter 3

Chapter 6

Chapter 7

 

Gunner Notes Beginning of the bovine story

http://beef2live.com/story-cattle-101-hist-breeds-fun-facts-terms-0-104671

 

Drovers

http://www.scotshistoryonline.co.uk/bridges/html/drovers.htm

 

Origin of “red neck”

http://www.scotshistoryonline.co.uk/rednecks/rednecks.html

 

 

You tube Reference Videos on Virus

https://www.youtube.com/watch?v=3Ms04x6MvMY

 

https://www.youtube.com/watch?v=Rpj0emEGShQ

 

How flu virus attack

https://www.youtube.com/watch?v=TVLo2CtB3GA

 

Today’s flow pattern Topic:

·      Graphs and what they show

·      Types of graphs

·      Linking graphs to two types of evolutionary change, punctuated and gradual change.

·      Using levels of energy in an ecosystem to explain punctuated equilibrium

·      Artificial Selection and Bovine history

·      Source of change, from previous ideas like Darwin and Lamark to genetic flow and drift.

·      Starting idea of alleles to allele frequency

·      Note that the graphs changes to a bell curve.

·      Case study on DDT: Example of accidental selection

·      Case study on Blood: Example of a favoured allele

 

New Topic

·      Taxonomy and alive or not alive.

·      The problems with trying to classify virus.

·      Cow handshake

·      Discovery of virus linked to pox history

·      Cause of disease and Koch’s postulate

·      Septic to antiseptic and disinfectant

·      Intro to the idea of immunity

Take Home Message  

Evolution in simple terms is a change with time. The mechanisms and rate of change with time depend upon changes in alleles and energy.

posted by Marc Bernard Carmichael in Biology Eleven,Biology Eleven Lesson Outline and have No Comments

Bio 11 SS Friday 8

Biology 11 Lesson Outline                                      Date July 8 th

 

 

Last lessons Objectives

 

 

 

1.   Evidence for evolution and classification

2.   Charting evolution with graphs

3.   Isolation mechanisms as evidence of how change could occur

 

Evaluation
Today’s Objectives 1.   History of evolutionary theory

·      Aristotle

·      Fixity of species

·      Cuvier and Buffon

·      Lamarck and Darwin

2.   Insect Dichotomous Key Lab

3.   Gene flow, Gene Pool and Evolution

Topic

Number One

History of evolutionary theory

 

Origin of “fixity of species”

 

Text based

https://ncse.com/book/export/html/5527

 

 

Wiki rf

https://en.wikipedia.org/wiki/History_of_evolutionary_thought

 

Powerpoints

http://www.slideshare.net/jjcorrea121/2011-15-ppt-evolution-and-natural-selection

 

http://www.slideshare.net/jjcorrea121/2011-15-ppt-evolution-and-natural-selection

 

Key Players in the history of evolution

Malthus

http://evolution.berkeley.edu/evolibrary/article/history_07

 

Lamarck

http://evolution.berkeley.edu/evolibrary/article/history_09

 

Buffon

http://evolution.berkeley.edu/evolibrary/article/history_06

 

Cuvier

http://evolution.berkeley.edu/evolibrary/article/history_08

 

Charles Lyell

Alfred Wallace

http://people.wku.edu/charles.smith/index1.htm

 

Topic

Number Two

 

Insect Lab and Darwin’s Finch Data

 

Darwin verses Lamarck

http://sciencenetlinks.com/student-teacher-sheets/lamarck-and-darwin-summary-theories/

 

Darwin’s six step “proof” to outline evolution

 

Evolution of Baba Brinkman videos

https://www.youtube.com/watch?v=ROgR3nK6ayk&list=RDirrKFXCoi0A&index=4

 

https://www.youtube.com/watch?v=apICqy01jo4

 

 

https://www.youtube.com/watch?v=apICqy01jo4&index=5&list=RDirrKFXCoi0A

 

 

Note:

These videos are the first rap songs to be peer reviewed. The author of this blog is offering these video to inspire critical thinking and debate.

 

Topic

Number Three

The new understanding of evolution

 

Gene Pool, Gene flow and evolution

 

Power points

http://slideplayer.com/slide/2378043/

 

http://slideplayer.com/slide/3907372/

 

http://slideplayer.com/slide/3529233/

 

Vocab

·      Gene Pool

·      Gene Flow

·      Bottleneck affect

·      Gene frequency

 

x
Debrief and new topic Find Gap Notes in the Bio 11 Notes

Good review for possible quizzes

·

Text Book

 

Class Notes

Chapter 2 and 3

Fossils Rocks

https://www.youtube.com/watch?v=ClJ5lwl_wM0&list=PLrPhCtnQNkWZZofdSPtQBwS-tnAtCjJif&index=7

 

Gunner Notes 1.   Looking at a timeline of evolution where does Pasteur fit in?

2.   Hurrah or Oorah..which do Marines say and why?

3.   New gunner song https://www.youtube.com/watch?v=6FAFOu7fkZk&index=104&list=PLrPhCtnQNkWZZofdSPtQBwS-tnAtCjJif

4.

You tube Reference Tree of life

https://www.youtube.com/watch?v=H6IrUUDboZo

 

Vocab
Take Home Message A duck is a duck. A theory is a theory.

 

posted by Marc Bernard Carmichael in Biology Eleven,Biology Eleven Lesson Outline and have No Comments

Microbiology PLO’s

BIOLOGY 11 UNIT E – MICROBIOLOGY

 

  1. PRESCRIBED LEARNING OUTCOMES

By the end of this unit, you must be able to:

 

  1. show an understanding of characteristics and functions of viruses and bacteria.

 

  1. Viruses
  • evaluate the evidence used to classify viruses as living or non-living
  • describe the structure of viruses
  • describe viral reproduction
  • evaluate the effects of viruses on humans
  1. Monera
  • analyse monerans as a lifeform at the prokaryotic level of organization
  • describe the structure and function of bacteria
  • describe moneran diversity
  • describe the roles and effects of bacteria
  • evaluate the effectiveness of various antibiotics, disinfectants, or antiseptics on bacterial cultures

 

 

  1. VOCABULARY

By the end of this unit, you must be able to define the following:

 

o     antibody

o     antigen

o     DNA

o     host cell

o     lymphocyte,

o     lysogenic cycle

o     lytic cycle

o     membranous envelope,

o     mucous membrane

o     nucleic acid core

o     phagocytic white blood cell

o     primary line of defence

o     protein capsid

o     RNA

o     secondary line of defence

o     tertiary line of defence

o     viral specificity

o     white blood cell

o     aerobic respiration

o     antibiotic

o     antiseptic

o     bacteria

o     binary fission

o     classification

o     conjugation

o     disinfectant

o     ecological role

o     fermentation

o     motility

o     mutate/mutation

o     photosynthesis

o     prokaryote

o     resistant/resistance

 

posted by Marc Bernard Carmichael in Biology Eleven,Biology Eleven Notes,Microbio and have No Comments

DNA Gap Notes

Biology 11

 

Name: ____________________ Date: __________ Block: _____

 

The Basic Structure of DNA

 

THE STRUCTURE OF DNA (pg 609, 613, 614)

DNA is a type of molecule called a ______________ acid. The basic units or “building blocks” of DNA are called ______________, and are arranged in long chains. Each of these units is made up of three subunits: a _____________, a _____________, and a _____________

 

 

 

 

 

 

 

A molecule of DNA is actually made up of 2 long molecules (called strands), twisted around each other into a shape called a __________________ . A strand of DNA is made up of many ______________ strung together, like beads on a chain. The alternating ______________ and ______________ are joined by chemical bonds, and form the “spine” or “backbone” of the DNA strand, with the ______________ sticking out the side.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

The number of different kinds of nitrogenous bases found in DNA is ____. Below are diagrams of the different bases. Name each base.

 

______________                        ______________

 

 

G

______________                        ______________

 

 

When two strands join together to form a double helix, the ______________ of the nucleotides join together with a chemical bond between them. These bonds are called hydrogen bonds.

 

Each base will only bond with its complementary base to form a complementary base pair:

 

 

– ______________ always bonds with ______________

 

 

– ______________ always bonds with ______________

 

 

The 2 strands form a ladder shape. The alternating ______________ and ______________ are the sides of the ladder, and the ______________ are the rungs of the ladder. When the ladder is twisted, it forms a ______________ shape.

 

 

 

 

 

 

 

Bases

 

 

 

 

 

 

 

 

 

 

 

How does DNA duplicate itself?

 

1) The ______________ between complementary bases break

2) The ______________ unravels (becomes untwisted), exposing unpaired bases

3) New ______________, with complementary bases, come and form ______________ bonds with the unpaired bases, forming a new chain.

4) Chemical bonds form between the ____________ and ____________ of the new nucleotides.

newly created strand
newly created strand

5) The result is 2 new ______________ of DNA, each of which has one strand from the original DNA and one strand that is newly created.

 

Every once in a while, a mistake happens while DNA is duplicating itself, and the new strand will be slightly different than the original strand. These mistakes are called _______________.

 

 

 

What are Genes?

 

(see pg 140) Genes are units of _______________ located on _______________ that produce or influence a specific trait in an individual.

 

Each gene consist of a length of DNA that contains instructions (the “code”) for making a specific proteins. Proteins are required for the structure, function, and regulation of the body’s cells, tissues, and organs.

 

 

 

 

Think of the bases along a single strand of DNA as being letters:

 

ATGCTCGAATAAATGTGAATTTGA

 

The letters make words:
ATG   CTC     GAA     TAA     ATG     TGA     ATT     TGA

 

The words make sentences:

 

< ATG   CTC     GAA   TAA     ATG     TGA     ATT   TGA>

 

These “sentences” are called genes. Each “word” in the sentence is called a codon, and codes for a different amino acid. Proteins are made of long strings of amino acids. The sentence as a whole is the code for a protein made up of a chain of amino acids assembled in a specific order.

 

We have approximately three billion pairs of nitrogenous bases in the DNA in most of our cells. This complete set of genes is called a genome. With the exception of identical twins, the sequence of the bases is different for everyone, which makes each of us unique.

 

Although we all look quite different from one another, we are surprisingly alike at the DNA level. the DNA of most people is 99.9 percent the same. And our DNA is 98% the same as a pygmy chimpanzee!!

What is RNA?

 

DNA doesn’t make proteins directly, instead, the DNA creates another molecule, called RNA, which functions as a messenger, carrying instructions from the DNA to organelles called _______________, that assemble proteins in the cytoplasm.

 

The nucleotides that make up RNA are very similar to those that make up DNA. However, instead of thymine, the nucleotides of RNA contain a nitrogenous base called uracil.

 

 

 

_______________ is replaced with                 ­­­_______________

 

 

How is RNA Formed?

 

RNA is formed through a process called transcription, and the process is controlled by an enzyme called RNA Polymerase

 

1) The ______________ bonds between complementary bases break.

2) The ______________ unravels (becomes untwisted), exposing unpaired bases.

3) New ______________, with complementary bases, come and form a new chain.

4) Chemical bonds form between the ____________ and ____________ of the new nucleotides.

5) Note that _______________ do NOT form between the complementary bases.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

How are Proteins Assembled?

 

The RNA moves out of the _______________ into the _______________, where it is used by the organelles called _______________ as a “template” for assembling _______________ into _______________ molecules.

 

The following chart shows all of the possible codons (formed by combinations of bases), and which amino acid corresponds to each codon:

 

 

Use the chart of amino acid codes to determine which amino acids will be formed by the following length of RNA (all that is shown are the bases in the RNA):

 

ACA – AGA – CGC – UAU – GUA – AAA – CAU – UCG – UGA

 

 

 

posted by Marc Bernard Carmichael in Biology Eleven,Biology Eleven Notes and have No Comments

Evolution PLO’s

BIOLOGY 11 UNIT C – EVOLUTION

 

  1. PRESCRIBED LEARNING OBJECTIVES

By the end of this unit, you must be able to:

 

1) describe the process of evolution

  1. describe the basic structure of deoxyribonucleic acid (DNA) with reference to the following terms:
    • double helix
    • sugar-phosphate backbone
    • nitrogenous bases (A, T, C, G)
    • complementary base pairing (A-T, C-G)
  2. explain the role of DNA in evolution
  3. describe the five agents of evolutionary change:
  • mutation
  • genetic drift
  • gene flow
  • non-random mating
  • natural selection
  1. differentiate among and give examples of convergent evolution, divergent evolution, and speciation
  2. compare the gradual change model with the punctuated equilibrium model of evolution

 

  1. VOCABULARY

By the end of this unit, you must be able to define the following:

 

o     complementary base pairing

o     convergent evolution

o     divergent evolution

o     deoxyribonucleic acid (DNA)

o     double helix

o     evolutionary change

o     gene flow

o     genetic drift

o     gradual change model

o     mutation

o     natural selection

o     nitrogenous base

o     non-random mating

o     punctuated equilibrium model

o     speciation

o     sugar- phosphate backbone

 

posted by Marc Bernard Carmichael in Biology Eleven,Biology Eleven Notes and have No Comments

Chapter 3 Gap Notes

Biology 11

Mr Carmichael

Name: ____________________ Date: __________ Block: _____

 

 

Chapter 3 – Theories to Explain Variation

Read pages 90-104. Use the text, sidebars, and illustrations to answer the questions below:

 

What is the purpose of scientific theories?

 

What do the theories of evolution attempt to explain?

 

Describe the theory of Jean-Baptiste de Lamarck

 

 

 

 

 

 

 

What is the main contribution of Lamarck to modern evolutionary theory?

 

 

Describe the theory of Charles Darwin

 

 

 

 

 

 

 

 

What is adaptation?

 

 

 

 

 

What are the three main types of adaptation? For each one, give three examples.

 

 

 

 

 

 

 

 

 

 

What is gradualism?

 

 

What is punctuated equilibrium?

 

 

Describe two causes of rapid evolution

 

 

 

 

posted by Marc Bernard Carmichael in Biology Eleven,Biology Eleven Notes and have No Comments

Simple Magnification Questions

Microscopes and Magnification

One of the tools that biologist use is the microscope. It function is to view a world that the normal eye cannot see. Stop for a moment and Imagine the first time some one saw moving matter under the lens. If you were that person, would you be afraid or full of wonder? This is a loaded question simply because now it is common to see magnified images of virus and bacteria in TV commercials. Perhaps the novelty is gone but the usage of the microscope remains a basic skill of any one studying biology.

Concept One: Power

“You’ve got the power…”, nope-wrong idea, but here is the scope. Power means the ability to make something bigger. End of story. The larger the power, the smaller the object you can view. The smaller the power, then you are already looking at organisms that are relatively large. The compound microscope enlarges images through a series of lens and mirrors. By illuminating the image, a reflection of that image passes through the lens to the eye. Starting with the eye is the ocular lens. This lens is used for viewing and is the lens that is adjusted to focus on an object. The objective lens is next to the object and remains stationary while viewing. So how much bigger is the object? Well if you take the ocular lens magnification (on the side of the lens) and multiply that number times the objective lens magnification ( on the side of the lens) you have the total magnification or power that the microscope enlarges the object. Here is the catch. Magnification in this context, is how many times larger is the object your are looking at. For example, at low power on a microscope, the ocular lens is let’s say (10x). This means that the lens will make the actual object 10 times larger. The objective lens is perhaps 5X. So the actual object will now appear ( 5×10) or 50 times larger than it is in real life.

So what!

Well if we are looking at objects under the microscope, we have to realize that the tool, the microscope, is altering what is actualy occurring under the lens. All that we view is now larger than life and just to keep things interesting, all images are inverted and upside down. So if you are looking at an organism swimming to the left of your field of view, it is actually upside down and swimming the opposite way. This may be helpful to remember the next time you are trying to draw a moving organism.

So how do we draw these critters? Well let’s use the worksheet to explain…

Prior to answering questions, lets come up with a strategy to organize our work. This will make life and marking a lot easier.

How to lay out your work: (save this as a template!)

Record facts Do work or calculations Answer

here here

Write formulas

here

Problems..

1.

Record facts Do work or calculations Answer

three lens 5 x 2 = 10 low power

2x 5 x 20 = 100 medium power

20x 5 x 200 = 1000 high power

200x

ocular=5x

Write formulas

ocular times objective = total power

2.

Record facts Do work or calculations Answer

field of diameter = 10 mm 10 mm/ 4 = 2.5 mm

Write formulas

field of diameter/ # of object = actual size

3.

Record facts Do work or calculations Answer

none use micrometer slide to measure

field of view

remember on average

low power field diameter

Write formulas

4.

Record facts Do work or calculations Answer

high power diameter .45 mm / 20 seconds = mm/sec

equals .45 mm always include units

Write formulas

field diameter (distance)

divided by time equals speed

5.

the source of light is actually quite good and can be focused to level of magnification, as you increase power, you need more light. The amount of light can be adjusted by using the diaphragm.
the organism may or may not be dead. If alive and you are using a slide with a concave depression in the slide, the critter is going to move up and down through the water. So you need to adjust focus as the critter moves. Correct answer
Usually the microscope remains at the same level of magnification. This may change not with time but with who is looking down the lens. Always remember to start with low power, switch to the next objective power and slowly adjust the fine tuning knob.
6.

Trick question…it depends on the type and size of cells. At low power, you would be able to see the largest field of view, so more distance. This is the obvious answer. However you may not be able to focus on small images and so you may have to move up to the next power to see these images. Don’t worry I don’t like trick questions either.

Questions

posted by Marc Bernard Carmichael in Biology Eleven,Biology Eleven Notes and have No Comments

Mr. C’s simple Chapter 1 and 2 notes

Chapter One/Two Notes:

Big Ideas in Biology
Unity and Diversity
Changes with time
Structure and Function
Review:

In chapter one, we attempt to observe and define some of the attributes of life. We note that all activities of life arise from living things. Through experimentation and the invention of the microscope, we can now theorize that all living things are composed of cells. Therefore; as basic units in biology we can state that cells are the basic unit of life and that there can be as many as six different activities of life observed by all living things. We also noted that in the subcellular level, cells are composed of molecules and that these molecules help regulate and continue the activities of life. We could say that we have outlined some of the parameters of what links all living things together. Therefor exploring part of one of the big ideas in biology, which is Unity and Diversity. Put simply there are several factors, including cellular and molecular structures and activities, which link all living things based upon cellular and molecular activities.

In this next chapter we are going to explore, the other half of this idea, that idea of diversity.

Developing an idea:

Idea Number One: Activities of Life and Adaptation

From the previous chapter, we noted that one of the activities of life is the ability to adapt.

Adaptations put simply is the ability to respond to changes in or around an organism. These changes allow the organism to improve chances of survival. This ability can be inherited and increase an organisms chance of survival.

Idea Number Two: Levels of organization

Level of Organization

Category

Atomic

There are basic elements found in each living thing,

these include Carbon, Nitrogen, Oxygen, Sulphur

Molecular

Each living thing needs nutrients in the form of

molecules. The nutrients can be classified as:

Fats and lipids-energy and structure

Carbohydrates- primary source of energy

Nucleic Acids- genetic material to regulate cell activities

Protein: structural and regulatory activities

Vitamin and Minerals: help in chemical reactions

Cellular

The cell is the basic unit of life

Cell types can be classified either as:

Prokaryotic: primitive cells, without nucleus and organelles (example: bacteria )

Eukaryotic: more advanced cells, with nucleus and organelles

Multicellular

Cells can combine to form organism which have more than one cell. This increases diversity of cell functions and can lead to organism with specific tissues ( cells all doing the same function) and organs ( group of tissues doing similar functions)

Species

Any organism which look alike and can interbreed with another similar organism, in natural conditions, and produce fertile offspring is said to be a species

Population

a group of organism all of the same species, occupying a given area at the same time

Community

a group of populations

Ecosystem

Several populations interacting with each other plus abiotic factors

Biome

A geographic region based upon a similarity in ecosytems and climate. Example Deserts, Tundra, Boreal forest.

The next question is:

” If organism can be so similar, then how do or how did they become so different?” To explain this change we have yet another theory classified under the concept of evolution. Evolution can be thought of as the change of organism over a period of time. This is yet another big idea in biology ” Changes with time”.

Some questions to ponder:

If organisms change with time, how can that change be shown?
Is the change shown similarity or diversity?
Does the change shown directly or indirectly?
If organism change with time, what is the mechanism that creates that change?
Types of proof in regards to evolution

Like the cell theory, we need proof or evidence to create a theory:

For the theory of evolution we have two types of proof

Direct Evidence
fossils offer direct evidence of pathway, or evolutionary history. This pathway can be considered to be a history to show origins of species and how they changed. This history can be used to explain organisms phylogenic or evolutionary history.
fossils are created due to preserved hard parts of organisms. Fossils can either be original body parts or imprints preserved or ” petrified” with mineral matter.
fossils can be used to show geological time scales
fossils can be used to show two types of evolution, called divergent and convergent evolution.
Divergent Evolution:
process where original organisms evolve into variety of distinct species. Each new population then becomes a new distinct species. Fossil histories can have gaps and so biologist have to hypothesis as to original species, which lead to a variety of species. Put simply a primitive ancestor has the potential to adapt to a variety of environments through structural changes, behavioral change or changes in reproduction. Divergent evolution often notes changes in structures of fossils to create ” family trees” for organisms.

Convergent Evolution:
process of development of similar forms from unrelated species due to adaptation to similar environment. Best example: Marsupials in Australia. Another definition: similar forms in geographically different areas responding to similar environments.

Comparing Divergence to Convergence:

convergent evolution occurs when two dissimilar species change in response to similar environmental conditions and show development of similar characteristics.

Example: Kangaroo and the deer

similarities: in location of eyes, type of teeth, long ears and herd behavior

dissimilarity: marsupial verses placental ancestors

Divergent evolution occurs when members within a singes species change in response to a new and different environmental condition, and each population develops into dissimilar characteristics.

Example: Primate ancestral groups evolving into specific of apes

Indirect Evidence
Often instead of looking at fossils, biologist can look at current species and use other methods to hypothesis their family background. If we assume that adaptation is an inherited trait, then we can look at patterns of inheritance through embryological , structural, physiological or biochemical evidence.

( remember: How many and what are the types of indirect proof ?)

Embryology:
Each organism starts off as a simple cell. If it divides into a multicellular organism the cells divide and create unique structures. An embryo is the prebirth stage of living organism. Embryology is the study of organisms in their earliest stages of development. In the 1800’s it was noted that several organisms show similarities in their embryonic development. This observation brought forth the statement and a theory of recapitulation:

” Ontogeny recapitulates Phylogeny”

In simple terms, each organism shows their evolutionary history ( phylogeny) in its own embryonic development ( ontogeny).

Homologous and Analogous Structures:
Homologous Structures:

Often organisms will have similar structures but these structures serve different functions. This is an example of an indirect proof of divergent evolution. Key thing to remember. Similar structure but different function.

Analogous Structures:

Often organisms will show structures that provide the same function but have differences in structure. Key point, similarity in function but not in structure. This can also be used as indirect proof of divergent evolution.

Vestigial Structures:

Sometimes creatures have structures that serve no apparent function, like hips on snakes or a human appendix. A structure with no apparent function is said to be vestigial.

Physiological Evidence:
Physiology:

How organs within an organism work is the study of physiology. For example observing and learning how organisms excrete waste, would be examining a physiological phenomenon. Tissues and chemical reactions within organs can be regulated by specific

posted by Marc Bernard Carmichael in Biology Eleven,Biology Eleven Notes and have No Comments

Mr. C’s Chapter 3 Notes

Chapter Three: Mechanisms of Change

Some notes to stimulate your appetite to think about the mechanisms of change and how to prepare for chapter three quiz.
In chapter two, we are introduced to evidence regarding showing change with time. The premise is this, from direct and indirect evidence; there are observations that show a change with time. This process of change with time can be shown in adaptations in populations of organisms. We have noted that this process can be shown using concepts such as speciation and isolation mechanisms. Basically, keep one species away from another and allow mating only to occur within this population, the chances are that a unique species will evolve. In chapter three, we begin to hypothesize about the mechanism that causes this change.

Historical note:

Though some philosophers have suggested that we learn nothing from observing history, the case is not the same for observing fossils. We begin with the notion that all species are fixed. No that does not mean neutered but that all species were put on the earth at a specific time and in a specific place. From a western philosophical point of view, those folks that were busy classifying nature never challenged this idea. Biologists were in fact part of a field of inquiry known as natural history and sometimes grouped with natural philosophers. For many years, “Naturalists” were quite content to just identify and classify and to create some universal means to classify all living things. Then the inquiry into how things worked began. The scientific method created a method of thinking to examine the world. Forces such as gravity and energy became the field of inquiry for scientists. From this inquiry came “laws” and interpretations of chemical and physical forces. As naturalist began to observe more history of organisms upon the earth, the inquiry began to follow the same pattern of questioning. What was going on? Why did organisms become extinct? Why were animals different? Were there unknown forces within nature, like the forces of gravity and Newtonian physics?

So now tracking information within the text. Who started asking questions about the fixity of species and how could this questioning affect how people perceived fossils? Once a question is asked, more will follow. So who proposed the idea of adaptations, the law of use and disuse? Why do you suppose he used a term such as “law”? Let’s make a few observations such as”: a heron has long legs, some insects are resistant to insecticides,and some organisms have thick skin or fur. How could we explain these adaptations from Lamarck and Darwin’s point of view?

Now lets get logical and examine some of the ideas proposed by both Lamarck and Darwin.

Here are some statements, can you identify ones that Darwin would support or Lamarck would support? Which Statements can be used with the other to create an argument?

Many types of variations exist within a species
Members of a species tend to increase in a geometric ration from generation to generation (example 2:4:8:16: 32)
Some variations have more survival value than others
Organisms in a population reproduce, but the population tends to remain constant
There is a struggle for survival
Organisms are able to adapt to their environment when they inherit variations that have been developed by their parents through use and disuse of certain organs
How would Darwin use some of these statements to support his mechanism of change? With both Darwin and Lamarck, we have a key problem to consider does the environment affect how an organism evolves, or does the organism have a means to adapt to the environment. One of the key issues is the notion of choice. If we accept the idea that the environment is selecting species, then does the notion of “free will” and “choice” have a place in human thought? So let’s look outside the realm of the human mind. Organisms on the planet have genetic material. This material allows organisms to display traits. This information, first shown by an inventive monk named Mendel remained unknown to both Lamarck and Darwin. So, while both were looking for a source of change, either within the organism or due to the environment neither of them knew about the origin and transmission of variation.

Darwin did consider domestic animal breeding and noted how humans could artificially select traits, but he still didn’t know about the source of these traits. He did suggest that through artificial breeding of animals, humans could “select” a desirable trait. However he was still in a muddle about the origins of traits or why some organisms produced infertile young. For example, the notion of a “hybrid”…which is a product of a cross of two species and in some cases can be infertile such as a donkey and horse was a mystery to Darwin. Darwin did note the formation of species, and the multiplication of species or speciation. He suggested that this process was gradual with time. Yet the more evidence that was brought forth challenged this portion of his idea. Can you define and show examples of the idea known as “punctuated equilibrium”?

Now here is the challenge…

Darwin suggested that his observations about finches in the Galapagos islands was an example of the process of evolution and that by noting this process, the mechanism for natural selection could be illustrated

…First of all…who offered the idea of a struggle for existence and natural selection to Darwin?

Now by using some of the terminology such as:

Isolation mechanisms

Speciation

Hybrid

Competition

Predators

Can you describe what occurred with the finches and why they changed with time? Remember to break up you explanation into two parts…the observations that showed a process and the concepts that explain the mechanism.

posted by Marc Bernard Carmichael in Biology Eleven,Biology Eleven Notes and have No Comments

Basic DNA Notes

Molecular Level of Genetics
Most of the molecules found in humans and other living organisms fall into one of four categories:

1. carbohydrates (sugars and starches) 2. lipids (fats, oils, and waxes)
3. proteins
4. nucleic acids

Proteins are large chain-like molecules that are twisted and folded back on themselves in complex patterns. They serve as structural material for the body, gas transporters, hormones , antibodies , neurotransmitters , and enzymes . In fact, when looking at someone, you mostly see proteins since skin and hair are primarily made of them. Proteins acting as enzymes are particularly important substances because they trigger and control the chemical reactions by which carbohydrates, lipids, and other substances are created. When you look at another human being, you mostly see proteins.

Our bodies produce about 90,000 thousand different kinds of proteins, all of which consist of sim- pler units called amino acids .

Proteins in all organisms are mostly composed of just 20 kinds of amino acids. Proteins differ in the number, sequence, and kinds of amino acids. Our bodies produce some of these amino acids, while others come directly from food that we consume.

AMINO ACIDS

Proteins, and subsequently amino acids, are mostly made up of just four elements: carbon, oxygen, hydrogen, and nitrogen. In fact, 96.3% of your body is composed of these common elements.

The largest molecules in people and other organisms are nucleic acids. Like proteins, they consist of very long chains of simpler units. However, the components, shapes, and functions of nucleic acids differ significantly from those of proteins. There are two basic varieties of nucleic acids: DNA (deoxyribonucleic acid ) and RNA (ribonucleic acid ). Both play critical roles in the produc- tion of proteins.

A chromosome consists mainly of one or more very long DNA molecules. Each of these molecules contains the genetic codes, or genes, for the synthesis of many different proteins and for the regula- tion of other genes. In a sense, a DNA molecule is a linear sequence of permanently stored blue- prints or recipes that are used regularly by our cells to make proteins out of amino acids.

alanine

glutamic acid

leucine

serine

arginine

glutamine

lysine

threonine

asparagine

glycine

methionine

tryptophan

Aspartic acid

histidine

phenylalanine

tyrosine

cysteine

isoleucine

proline

valine

1

DNA molecules in all living things have the shape of a double helix , which is like a twisted lad- der. The sides of the ladder are composed of sugar and phosphate units, while the rungs consist of complementary pairs of four different chemical bases. Each combined sugar, phosphate, and base subunit is a nucleotide

s = sugar
p = phosphate

g = guanine c = cytosine a = adenine t = thymine

bases

Section of a DNA molecule showing the double helix molecular shape

The sequence of bases from one nucleotide to the next in line is the code for the assembly of spe- cific amino acids to make specific types of proteins. Therefore, a gene is essentially a specific sequence of these base pairs. The sequence need not be continuous but can be divided into differ- ent sections of a DNA molecule. Apparently, only 1.2-1.5% of the 2.9 billion base pairs in human DNA actually code for genes. These meaningful code sequences are called exons . The remaining 98+% of our DNA base pairs were in the past thought to consist merely of genetic “junk”, referred to as introns . However, it is now becoming clear that much of this “junk” actually has important functions. Some of the introns act as subtle enhancers of genes. Others function as buffers against change by absorbing the mutagenic effect of viruses. Still others help determine the shape of chromosomes. It is likely that future research will discover that the “non-gene” intron code sec- tions, that make up the bulk of DNA, perform still other important tasks.

NOTE: Textbooks written before 2001 most often indicated that there are 100,000 human genes and that 3+% of our DNA base pairs are parts of genes. These estimates were significantly reduced as a result of completion of the entire human genome mapping announced by spokesmen for the Human Genome Project in February 2001. It is now believed that there are only about 32,000 human genes. However, many of these genes apparently code for several different proteins. Now that the human genome “parts list” has been compiled, research will be focused on what these parts do–i.e., what proteins they code for and what those proteins do in our bodies.

Not all of our DNA is in the cell nuclei. A small amount is in the mitochondria , which are located in the cytoplasm and mostly produce fuel for cell functions. Mitochondrial DNA (mtDNA) is nor- mally inherited only from our mothers and is unrelated to the nuclear DNA (nDNA) in chromo- somes. The 13 or more genes of mtDNA appear to have relatively few functions.

2

The second type of nucleic acid, RNA, consists of molecules that are single stranded copies of nuclear DNA segments. They are smaller than DNA molecules and do not have the double helix shape. In addition, the DNA base

thymine is replaced by the RNA base uracil.
The sugar component is also somewhat differ-
ent. RNA is found in both the cell nucleus and the cytoplasm.

In order to understand what RNA does, we need to first examine
how the DNA code is transcribed, or copied, to RNA. The
process begins by a section of a DNA moleculeunwinding and then unzipping in response to a specific enzyme. The separation occurs between the bases, as shown below.

DNA molecule unwinding and unzipping along the base pairs

DNA molecule partially unwinding and unzipping along the base pairs

Free complementary nucleotides in the nucleus are attracted to the now unattached DNA bases on the exposed strands. The result is the formation of a messenger RNA (mRNA) molecule that is a copy, or transcription, of a specific section of the nuclear DNA moleculecorresponding to a gene. Many identical copies are made, one right after another.

mRNA forming free nucleotides

Free nucleotides attracted to exposed bases of a partially unzipped DNA molecule

Free complementary nucleotides in the nucleus are attracted to the now unattached DNA bases on the exposed strands. The result is the formation of a messenger RNA (mRNA) molecule that is a copy, or transcription, of a specific section of the nuclear DNA molecule corresponding to a gene. Many identicopies are made, one right after another.

mitochondria

Generalized animal cell

3

These new identical messenger RNA molecules then leave the nucleus and go out into the cytoplasm where the protein they are coded for is actually synthesized or assembled.

mRNA migrating out of the cell nucleus

Specifically, the messenger RNA molecules migrate from the chromosomes to the ribosomes, which are small graules in the cytoplasm. Some ribosome are on the surface of mem- brane networks called endoplasmic reticula , while others are free ribosomes. Assembly of proteins takes place at the site of the ribosomes

DNA copied

mRNA migrates to cytoplasm

Generalized animal cell

Protein synthesis begins as ribosomes move along the messenger RNA strand and attach transfer RNA (tRNA) anticodons (each with 3 bases) to triplets of complementary bases on the mRNA.

protein molecule forming

Protein synthesis at the ribosomes initiated by mRNA momentarily bonding with tRNA (Note: this schematic representation is a simplification of the actual process.)

Each transfer RNA attracts and brings a specific amino acid along with it. As a ribosome translates the messenger RNA code, a protein is assembled lineally, one amino acid at a

chromosomes ribosomes

(small dots)

endoplasmic reticula

4

time. Each kind of amino acid has a single codon that specifies it. A codon is a sequence of 3 nucleotide components chemically bound together (illustrated below). As mentioned above, every nucleotide consists of a sugar, a phosphate, and a base. Codons differ in terms of the sequence of their 3 bases. For example, the sequence CAG

(cytosine-adenine-guanine) is a code for the amino acid glutamine.
This simple genetic code permits 64 different codons because each of the 3 nucle-otides can have 1ofthe4bases(4x4x4=64). Since

P = phosphate S = sugar
B = base

there are many fewer than 64 amino acids,
the code system has built in redundancy–
most amino acids can be attracted by Sugar-phosphate-base chemical bond of a codon transfer RNA having several different base triplets. In other words, some codons are functionally equivalent, as shown in the table below. For instance, asparagine is specified with the sequence AAU (adenine-adenine-uracil). However, AAC (adenine-adenine-cytosine) also works.

Amino Acids

DNA Codons

mRNA Codons

alanine

CGA, CGG, CGT, CGC

GCU, GCC, GCA, GCG

arginine

GCA, GCG, GCT, GCC, TCT, TCC

CGU, CGC, CGA, CGG, AGA, AGG

asparagine

TTA, TTG

AAU, AAC

aspartic acid

CTA, CTG

GAU, GAC

cysteine

ACA, ACG

UGU, UGC

glutamic acid

CTT,CTC

GAA, GAG

glutamine

GTT, GTC

CAA, CAG

glycine

CCA, CCG, CCT, CCC

GGU, GGC, GGA, GGG

histidine

GTA, GTG

CAU, CAC

isoleucine

TAA, TAG, TAT

AUU, AUC, AUA

leucine

AAT, AAC, GAA, GAG, GAT, GAC

UUA, UUG, CUU, CUC, CUA, CUG

lysine

TTT, TTC

AAA, AAG

methionine (start codon)

TAC

AUG

phenylalanine

AAA, AAG

UUU, UUC

proline

GGA, GGG, GGT, GGC

CCU, CCC, CCA, CCG

serine

AGA, AGG, AGT, AGC, TCA, TCG

UCU, UCC, UCA, UCG, AGU, AGC

threonine

TGA, TGG, TGT, TGC

ACU, ACC, ACA, ACG

tryptophan

ACC

UGG

tyrosine

ATA, ATG

UAU, UAC

valine

CAA, CAG, CAT, CAC

GUU, GUC, GUA, GUG

(stop codon)

ATT, ATC, ACT

UAA, UAG, UGA

(The DNA base thymine is replaced with uracil in the formation of mRNA.) 5

DNA unwinding and unzipping

new DNA forming

free nucleotides

Not all codons specify amino acid components to be included in a protein. For instance, a start codon appears in DNA at thebeginning of the lineal code sequence for each gene and a stop codon is at the end. In other words, they indicate where a protein recipe begins and ends.

Most plant and animal cells have tens of thousands of ribosomes. Many ribosomes simultaneously translate identical strands of messenger RNA. As a result, the synthesis of proteins can be rapid and massive. These same processes can occur at the same time in millions of cells when a particu- lar protein is needed.

In addition to keeping the blueprints for protein synthesis, DNA has one further function–it replicates, or duplicates, itself. At the beginning of this process, the parent DNA molecule unwinds and unzips along its bases beginning at one end. Then in response to an enzyme, free nucleotides pair up with cor- responding bases on both of the DNA strands, as illustrated below. This results in the formation of two exact copies of the original molecule. Nuclear DNA replication occurs just before mitosis and meiosis.

DNA replication

Occasionally, an error is made in DNA replication. For example, an incorrect base pair may be included. This constitutes a mutation. If it occurs in the formation of sex cells, the mutation may be inherited and passed on in future generations. Such errors in replication are the ultimate sources of all new genes and are essential for the evolution of new species. They are also responsible for changes in somatic cells that result in the uncontrolled tumorgrowths of cancer.

It is important to realize that the genetic code system of humans is not unique but is shared by all living things. The same codons code for the same amino acids in people, dogs, fleas, and even bac- teria. In addition, we share many genes with other creatures. For instance, about 90% of human genes are identical to those of a mouse. Even more surprising is the fact that more than 1/3 of our genes are shared with a primitive group of worm species known as nematodes. The universal nature of the genetic code is compelling evidence for the evolution of all organisms from the same early life forms.

©1998, 2000 by Dennis O’Neil. Used by permission of the author.

posted by Marc Bernard Carmichael in Biology Eleven,Biology Eleven Notes and have No Comments