Biology 11

Name: ________________________ Date: __________ Block: _____

Introduction to Plants

(pages 245 – 246 in Text)

Biology 11

Name: ________________________ Date: __________ Block: _____

Algae

(pages 246 – 248 in Text)

Test 1 : Scientific Method,

Taxonomy & the Five Kingdoms

Check the PLO’s for taxonomy

Look in Chapter 7 for how to classify

Can you identify name a human by family, genus and species?

What are the Five Kingdoms and how could you take a common name like..slime mold and put it into the correct kingdom.

What is the scientific method and how does it work.

What is a hypothesis?

What is the difference between a controlled and non controlled experiment?

Do experiments always support the initial hypothesis?

Which has more evidence, an experiment or a theory?

What makes a testable idea become a theory?

What are simple facts to identify simple facts about theories?

• abiogenesis
• biogenesis
• cell theory
• evolution

RF

http://modeling.asu.edu/modeling/LawsonA-BasicBioTheories.pdf

Remember to sleep!

Mr. C’s Top Ten Questions About Virus

Question One: Are Virus living things?

Non living Characteristics

Living Characteristics

they do not respire

they do have DNA or RNA

there is no cellular structure

they do have proteins and enzymes

they do not grow

they have the potential to make other cells make copies of themselves, this is more like duplication than reproduction

they can be crystallised due to harsh environments

virus show diversity associated with the hosts they infect

they cannot reproduce on their own

* this is a great table for a test question….

Question Two: What are virus and where did they come from?

Virus may be linked to the original entity of life as a noncellular ancestor of cells
Their means of existence may imply that they were once primitive organisms that loss cell structures in order to assist parasitic lifestyle.
The genetic material within a virus is only a fragment of an original genome.
Question Three:

What is the structure of a virus and how is it associated with its lifestyle.

Most virus are composed of a protein coat which surrounds a small fragment of DNA or RNA.
Most virus are only visible with electron microscopes ranging in size from .015 to .45 microns.
Some of the protein coats are specialised for the host that the virus infects.
The shape of the protein coat may vary from spherical shapes to bacteriophage which have additional structures to add attachment to host.
Shapes are usually spherical, rod shaped or tadpole shaped.
Question Four: How are virus classified?

Virus are classified by the host they infect
Plant virus: ( example tobacco mosaic virus)
Animal ( by class: Aves : Bird, Insecta: insects) virus
Bacteria virus or Bacterio phage
Question Five: How are virus transmitted?

In plants: virus can be transmitted from contact with insects, direct contact between plant seeds, leaves or stems.
In animals: virus can be transmitted from coughing, sneezing, talking, direct contact and insects.
Question Six: How do virus infect host

A general infection follows the following pattern.

The virus comes in contact with host cell and attaches to host cell.
Viral Protein coat is either removed after absorption by host or virus injects nucleic material into host.
Viral DNA or RNA is replicated by the host cell.
Replicated viral DNA or RNA is translated into proteins for viral enzymes and protein coat.
New virus are assembled within host cell from replicated and translated material.
Virus either remain in host or host cell breaks due to too many virus within cell.
Specialised infections:

Bacteriophage: Virus that infect bacteria

In this type of infection there is the possibility of two events

a) A lytic cycle

Virus attaches to host bacteria, an enzyme eats away the host’s cell wall and viral nucleic material is injected into host
Viral nucleic material is incorporated into host nucleic material
Viral nucleic material begins to replicate and translate its code, this takes over the bacteria normal cellular functions.
As many as 100 or more copies of the original virus are made by host bacteria
The host bacteria burst and virus is release to the environment. The word lytic comes from the Latin which means to burst open
b) A lysogenic cycle.

Much like the lytic cycle the host bacteria is infected by the virus, however lyses of the bacteria does not happen immediately. Bursting of the cell only occurs when the bacteria become weakened or there is a change in the environment.

c) Mutagenic

some virus will not cause the cell to lyse or die but will cause mutations which can change the growth rate of the cell or the shape and size of cells. Some of these viruses have been linked to creating cancer cells. Remember…one of the characteristics of cancer cells are their growth rate and change is morphology.

Retrovirus Infections:

A retrovirus is a RNA virus which infects the host in a unique fashion.
The viral RNA serves as a template for the host cell to make a segment of DNA.
This DNA is then encoded into the host’s genetic material.
The cell does not die but changes due to the new encoded material.
The mechanisms of this type of infection are still being researched.
Question Seven: Are all infections the same?

The answer is no. There are at least three possible outcomes from an infection:

Results of viral infection can be:

A virulent infection:
This is when the virus causes a lytic cycle and the host cell dies
A latent infection:
This is when the virus either becomes part of host genome or remains dormant until changes in host cell and or external environment.
Tumour producing infection:
This is when the host cell is not destroyed but mutated causing the host cell to divide and produce cluster of cells that have changed from the original cell. If these cells remain dormant they are said to be benign and show themselves as a wart or tumour), if these cells become mobile, they are said to be malignant.
Question Eight: What diseases are caused by viral infections?

Some common viral infections are:
viral pneumonia, the common cold, influenza, mumps, measles, German measles polio shingles chickenpox smallpox, AIDS virus hepatitis warts yellow fever cold sores hoof and mouth disease Ebstein Barr virus mosiacs in plants

May be associated with some cancers, leukaemia’s, and autoimmune disorders
Some lethal viruses: Ebola (95% fatality rate)
Most publicised virus: HIV

Question Nine: Is there a way to treat or cure viral infections?

One of the first methods of preventing infection by virus was done by the Chinese, who rubbed other individuals with skin scabs from those individuals who survived a viral infection such as small pox.
Edward Jenner, created a process called vaccination ( from the Latin origin vaca for cow : another famous cow story!) by exposing individuals to cowpox virus, which he noted prevented them from being infected from a more virulent virus for small pox.
It is useless to treat a viral infection with antibiotics however people treated with a killed strain of virus or viral proteins may create their own antibodies to attack onto viral proteins.
Question Ten: How were virus discovered?

Discovery of virus were initially related to nature of infection of hosts
Actual viral material viral material was not purified until 1933 by Stanley. This particular material was crystallise tobacco mosaic.
Identification of viruses has improved with the increased efficiency of electron microscopes.
Because viral DNA/RNA interacts with host nucleic material, viruses are continue to change and evolve.
If you have any further questions you wish to explore…contact Mr. C

Biology 11

Name: ____________________ Date: __________ Block: _____

The Basic Structure of DNA

THE STRUCTURE OF DNA (pg 609, 613, 614)

DNA is a type of molecule called a ______________ acid. The basic units or “building blocks” of DNA are called ______________, and are arranged in long chains. Each of these units is made up of three subunits: a _____________, a _____________, and a _____________

A molecule of DNA is actually made up of 2 long molecules (called strands), twisted around each other into a shape called a __________________ . A strand of DNA is made up of many ______________ strung together, like beads on a chain. The alternating ______________ and ______________ are joined by chemical bonds, and form the “spine” or “backbone” of the DNA strand, with the ______________ sticking out the side.

The number of different kinds of nitrogenous bases found in DNA is ____. Below are diagrams of the different bases. Name each base.

______________                        ______________

______________                        ______________

When two strands join together to form a double helix, the ______________ of the nucleotides join together with a chemical bond between them. These bonds are called hydrogen bonds.

Each base will only bond with its complementary base to form a complementary base pair:

– ______________ always bonds with ______________

– ______________ always bonds with ______________

The 2 strands form a ladder shape. The alternating ______________ and ______________ are the sides of the ladder, and the ______________ are the rungs of the ladder. When the ladder is twisted, it forms a ______________ shape.

How does DNA duplicate itself?

1) The ______________ between complementary bases break

2) The ______________ unravels (becomes untwisted), exposing unpaired bases

3) New ______________, with complementary bases, come and form ______________ bonds with the unpaired bases, forming a new chain.

4) Chemical bonds form between the ____________ and ____________ of the new nucleotides.

5) The result is 2 new ______________ of DNA, each of which has one strand from the original DNA and one strand that is newly created.

Every once in a while, a mistake happens while DNA is duplicating itself, and the new strand will be slightly different than the original strand. These mistakes are called _______________.

What are Genes?

(see pg 140) Genes are units of _______________ located on _______________ that produce or influence a specific trait in an individual.

Each gene consist of a length of DNA that contains instructions (the “code”) for making a specific proteins. Proteins are required for the structure, function, and regulation of the body’s cells, tissues, and organs.

Think of the bases along a single strand of DNA as being letters:

ATGCTCGAATAAATGTGAATTTGA

The letters make words:
ATG   CTC     GAA     TAA     ATG     TGA     ATT     TGA

The words make sentences:

< ATG   CTC     GAA   TAA     ATG     TGA     ATT   TGA>

These “sentences” are called genes. Each “word” in the sentence is called a codon, and codes for a different amino acid. Proteins are made of long strings of amino acids. The sentence as a whole is the code for a protein made up of a chain of amino acids assembled in a specific order.

We have approximately three billion pairs of nitrogenous bases in the DNA in most of our cells. This complete set of genes is called a genome. With the exception of identical twins, the sequence of the bases is different for everyone, which makes each of us unique.

Although we all look quite different from one another, we are surprisingly alike at the DNA level. → the DNA of most people is 99.9 percent the same. And our DNA is 98% the same as a pygmy chimpanzee!!

What is RNA?

DNA doesn’t make proteins directly, instead, the DNA creates another molecule, called RNA, which functions as a messenger, carrying instructions from the DNA to organelles called _______________, that assemble proteins in the cytoplasm.

The nucleotides that make up RNA are very similar to those that make up DNA. However, instead of thymine, the nucleotides of RNA contain a nitrogenous base called uracil.

_______________ is replaced with                 ­­­_______________

How is RNA Formed?

RNA is formed through a process called transcription, and the process is controlled by an enzyme called RNA Polymerase

1) The ______________ bonds between complementary bases break.

2) The ______________ unravels (becomes untwisted), exposing unpaired bases.

3) New ______________, with complementary bases, come and form a new chain.

4) Chemical bonds form between the ____________ and ____________ of the new nucleotides.

5) Note that _______________ do NOT form between the complementary bases.

How are Proteins Assembled?

The RNA moves out of the _______________ into the _______________, where it is used by the organelles called _______________ as a “template” for assembling _______________ into _______________ molecules.

The following chart shows all of the possible codons (formed by combinations of bases), and which amino acid corresponds to each codon:

Use the chart of amino acid codes to determine which amino acids will be formed by the following length of RNA (all that is shown are the bases in the RNA):

ACA – AGA – CGC – UAU – GUA – AAA – CAU – UCG – UGA