" The Big Picture!" by Mr C

Biology 11

Name: ____________________ Date: __________ Block: _____

The Basic Structure of DNA

THE STRUCTURE OF DNA (pg 609, 613, 614)

DNA is a type of molecule called a ______________ acid. The basic units or “building blocks” of DNA are called ______________, and are arranged in long chains. Each of these units is made up of three subunits: a _____________, a _____________, and a _____________

A molecule of DNA is actually made up of 2 long molecules (called strands), twisted around each other into a shape called a __________________ . A strand of DNA is made up of many ______________ strung together, like beads on a chain. The alternating ______________ and ______________ are joined by chemical bonds, and form the “spine” or “backbone” of the DNA strand, with the ______________ sticking out the side.

The number of different kinds of nitrogenous bases found in DNA is ____. Below are diagrams of the different bases. Name each base.

______________                        ______________

______________                        ______________

When two strands join together to form a double helix, the ______________ of the nucleotides join together with a chemical bond between them. These bonds are called hydrogen bonds.

Each base will only bond with its complementary base to form a complementary base pair:

– ______________ always bonds with ______________

– ______________ always bonds with ______________

The 2 strands form a ladder shape. The alternating ______________ and ______________ are the sides of the ladder, and the ______________ are the rungs of the ladder. When the ladder is twisted, it forms a ______________ shape.

How does DNA duplicate itself?

1) The ______________ between complementary bases break

2) The ______________ unravels (becomes untwisted), exposing unpaired bases

3) New ______________, with complementary bases, come and form ______________ bonds with the unpaired bases, forming a new chain.

4) Chemical bonds form between the ____________ and ____________ of the new nucleotides.

5) The result is 2 new ______________ of DNA, each of which has one strand from the original DNA and one strand that is newly created.

Every once in a while, a mistake happens while DNA is duplicating itself, and the new strand will be slightly different than the original strand. These mistakes are called _______________.

What are Genes?

(see pg 140) Genes are units of _______________ located on _______________ that produce or influence a specific trait in an individual.

Each gene consist of a length of DNA that contains instructions (the “code”) for making a specific proteins. Proteins are required for the structure, function, and regulation of the body’s cells, tissues, and organs.

Think of the bases along a single strand of DNA as being letters:

ATGCTCGAATAAATGTGAATTTGA

The letters make words:
ATG   CTC     GAA     TAA     ATG     TGA     ATT     TGA

The words make sentences:

< ATG   CTC     GAA   TAA     ATG     TGA     ATT   TGA>

These “sentences” are called genes. Each “word” in the sentence is called a codon, and codes for a different amino acid. Proteins are made of long strings of amino acids. The sentence as a whole is the code for a protein made up of a chain of amino acids assembled in a specific order.

We have approximately three billion pairs of nitrogenous bases in the DNA in most of our cells. This complete set of genes is called a genome. With the exception of identical twins, the sequence of the bases is different for everyone, which makes each of us unique.

Although we all look quite different from one another, we are surprisingly alike at the DNA level. → the DNA of most people is 99.9 percent the same. And our DNA is 98% the same as a pygmy chimpanzee!!

What is RNA?

DNA doesn’t make proteins directly, instead, the DNA creates another molecule, called RNA, which functions as a messenger, carrying instructions from the DNA to organelles called _______________, that assemble proteins in the cytoplasm.

The nucleotides that make up RNA are very similar to those that make up DNA. However, instead of thymine, the nucleotides of RNA contain a nitrogenous base called uracil.

_______________ is replaced with                 ­­­_______________

How is RNA Formed?

RNA is formed through a process called transcription, and the process is controlled by an enzyme called RNA Polymerase

1) The ______________ bonds between complementary bases break.

2) The ______________ unravels (becomes untwisted), exposing unpaired bases.

3) New ______________, with complementary bases, come and form a new chain.

4) Chemical bonds form between the ____________ and ____________ of the new nucleotides.

5) Note that _______________ do NOT form between the complementary bases.

How are Proteins Assembled?

The RNA moves out of the _______________ into the _______________, where it is used by the organelles called _______________ as a “template” for assembling _______________ into _______________ molecules.

The following chart shows all of the possible codons (formed by combinations of bases), and which amino acid corresponds to each codon:

Use the chart of amino acid codes to determine which amino acids will be formed by the following length of RNA (all that is shown are the bases in the RNA):

ACA – AGA – CGC – UAU – GUA – AAA – CAU – UCG – UGA

BIOLOGY 11 UNIT C – EVOLUTION

1. PRESCRIBED LEARNING OBJECTIVES

By the end of this unit, you must be able to:

1) describe the process of evolution

1. describe the basic structure of deoxyribonucleic acid (DNA) with reference to the following terms:
   • double helix
   • sugar-phosphate backbone
   • nitrogenous bases (A, T, C, G)
   • complementary base pairing (A-T, C-G)
2. explain the role of DNA in evolution
3. describe the five agents of evolutionary change:

• mutation
• genetic drift
• gene flow
• non-random mating
• natural selection

1. differentiate among and give examples of convergent evolution, divergent evolution, and speciation
2. compare the gradual change model with the punctuated equilibrium model of evolution

1. VOCABULARY

By the end of this unit, you must be able to define the following:

Biology 11

Mr Carmichael

Name: ____________________ Date: __________ Block: _____

Chapter 3 – Theories to Explain Variation

Read pages 90-104. Use the text, sidebars, and illustrations to answer the questions below:

Microscopes and Magnification

One of the tools that biologist use is the microscope. It function is to view a world that the normal eye cannot see. Stop for a moment and Imagine the first time some one saw moving matter under the lens. If you were that person, would you be afraid or full of wonder? This is a loaded question simply because now it is common to see magnified images of virus and bacteria in TV commercials. Perhaps the novelty is gone but the usage of the microscope remains a basic skill of any one studying biology.

Concept One: Power

“You’ve got the power…”, nope-wrong idea, but here is the scope. Power means the ability to make something bigger. End of story. The larger the power, the smaller the object you can view. The smaller the power, then you are already looking at organisms that are relatively large. The compound microscope enlarges images through a series of lens and mirrors. By illuminating the image, a reflection of that image passes through the lens to the eye. Starting with the eye is the ocular lens. This lens is used for viewing and is the lens that is adjusted to focus on an object. The objective lens is next to the object and remains stationary while viewing. So how much bigger is the object? Well if you take the ocular lens magnification (on the side of the lens) and multiply that number times the objective lens magnification ( on the side of the lens) you have the total magnification or power that the microscope enlarges the object. Here is the catch. Magnification in this context, is how many times larger is the object your are looking at. For example, at low power on a microscope, the ocular lens is let’s say (10x). This means that the lens will make the actual object 10 times larger. The objective lens is perhaps 5X. So the actual object will now appear ( 5×10) or 50 times larger than it is in real life.

So what!

Well if we are looking at objects under the microscope, we have to realize that the tool, the microscope, is altering what is actualy occurring under the lens. All that we view is now larger than life and just to keep things interesting, all images are inverted and upside down. So if you are looking at an organism swimming to the left of your field of view, it is actually upside down and swimming the opposite way. This may be helpful to remember the next time you are trying to draw a moving organism.

So how do we draw these critters? Well let’s use the worksheet to explain…

Prior to answering questions, lets come up with a strategy to organize our work. This will make life and marking a lot easier.

How to lay out your work: (save this as a template!)

Record facts Do work or calculations Answer

here here

Write formulas

here

Problems..

1.

Record facts Do work or calculations Answer

three lens 5 x 2 = 10 low power

2x 5 x 20 = 100 medium power

20x 5 x 200 = 1000 high power

200x

ocular=5x

Write formulas

ocular times objective = total power

2.

Record facts Do work or calculations Answer

field of diameter = 10 mm 10 mm/ 4 = 2.5 mm

Write formulas

field of diameter/ # of object = actual size

3.

Record facts Do work or calculations Answer

none use micrometer slide to measure

field of view

remember on average

low power field diameter

Write formulas

4.

Record facts Do work or calculations Answer

high power diameter .45 mm / 20 seconds = mm/sec

equals .45 mm always include units

Write formulas

field diameter (distance)

divided by time equals speed

5.

the source of light is actually quite good and can be focused to level of magnification, as you increase power, you need more light. The amount of light can be adjusted by using the diaphragm.
the organism may or may not be dead. If alive and you are using a slide with a concave depression in the slide, the critter is going to move up and down through the water. So you need to adjust focus as the critter moves. Correct answer
Usually the microscope remains at the same level of magnification. This may change not with time but with who is looking down the lens. Always remember to start with low power, switch to the next objective power and slowly adjust the fine tuning knob.
6.

Trick question…it depends on the type and size of cells. At low power, you would be able to see the largest field of view, so more distance. This is the obvious answer. However you may not be able to focus on small images and so you may have to move up to the next power to see these images. Don’t worry I don’t like trick questions either.

Questions

Chapter One/Two Notes:

Big Ideas in Biology
Unity and Diversity
Changes with time
Structure and Function
Review:

In chapter one, we attempt to observe and define some of the attributes of life. We note that all activities of life arise from living things. Through experimentation and the invention of the microscope, we can now theorize that all living things are composed of cells. Therefore; as basic units in biology we can state that cells are the basic unit of life and that there can be as many as six different activities of life observed by all living things. We also noted that in the subcellular level, cells are composed of molecules and that these molecules help regulate and continue the activities of life. We could say that we have outlined some of the parameters of what links all living things together. Therefor exploring part of one of the big ideas in biology, which is Unity and Diversity. Put simply there are several factors, including cellular and molecular structures and activities, which link all living things based upon cellular and molecular activities.

In this next chapter we are going to explore, the other half of this idea, that idea of diversity.

Developing an idea:

Idea Number One: Activities of Life and Adaptation

From the previous chapter, we noted that one of the activities of life is the ability to adapt.

Adaptations put simply is the ability to respond to changes in or around an organism. These changes allow the organism to improve chances of survival. This ability can be inherited and increase an organisms chance of survival.

Idea Number Two: Levels of organization

Level of Organization

Category

Atomic

There are basic elements found in each living thing,

these include Carbon, Nitrogen, Oxygen, Sulphur

Molecular

Each living thing needs nutrients in the form of

molecules. The nutrients can be classified as:

Fats and lipids-energy and structure

Carbohydrates- primary source of energy

Nucleic Acids- genetic material to regulate cell activities

Protein: structural and regulatory activities

Vitamin and Minerals: help in chemical reactions

Cellular

The cell is the basic unit of life

Cell types can be classified either as:

Prokaryotic: primitive cells, without nucleus and organelles (example: bacteria )

Eukaryotic: more advanced cells, with nucleus and organelles

Multicellular

Cells can combine to form organism which have more than one cell. This increases diversity of cell functions and can lead to organism with specific tissues ( cells all doing the same function) and organs ( group of tissues doing similar functions)

Species

Any organism which look alike and can interbreed with another similar organism, in natural conditions, and produce fertile offspring is said to be a species

Population

a group of organism all of the same species, occupying a given area at the same time

Community

a group of populations

Ecosystem

Several populations interacting with each other plus abiotic factors

Biome

A geographic region based upon a similarity in ecosytems and climate. Example Deserts, Tundra, Boreal forest.

The next question is:

” If organism can be so similar, then how do or how did they become so different?” To explain this change we have yet another theory classified under the concept of evolution. Evolution can be thought of as the change of organism over a period of time. This is yet another big idea in biology ” Changes with time”.

Some questions to ponder:

If organisms change with time, how can that change be shown?
Is the change shown similarity or diversity?
Does the change shown directly or indirectly?
If organism change with time, what is the mechanism that creates that change?
Types of proof in regards to evolution

Like the cell theory, we need proof or evidence to create a theory:

For the theory of evolution we have two types of proof

Direct Evidence
fossils offer direct evidence of pathway, or evolutionary history. This pathway can be considered to be a history to show origins of species and how they changed. This history can be used to explain organisms phylogenic or evolutionary history.
fossils are created due to preserved hard parts of organisms. Fossils can either be original body parts or imprints preserved or ” petrified” with mineral matter.
fossils can be used to show geological time scales
fossils can be used to show two types of evolution, called divergent and convergent evolution.
Divergent Evolution:
process where original organisms evolve into variety of distinct species. Each new population then becomes a new distinct species. Fossil histories can have gaps and so biologist have to hypothesis as to original species, which lead to a variety of species. Put simply a primitive ancestor has the potential to adapt to a variety of environments through structural changes, behavioral change or changes in reproduction. Divergent evolution often notes changes in structures of fossils to create ” family trees” for organisms.

Convergent Evolution:
process of development of similar forms from unrelated species due to adaptation to similar environment. Best example: Marsupials in Australia. Another definition: similar forms in geographically different areas responding to similar environments.

Comparing Divergence to Convergence:

convergent evolution occurs when two dissimilar species change in response to similar environmental conditions and show development of similar characteristics.

Example: Kangaroo and the deer

similarities: in location of eyes, type of teeth, long ears and herd behavior

dissimilarity: marsupial verses placental ancestors

Divergent evolution occurs when members within a singes species change in response to a new and different environmental condition, and each population develops into dissimilar characteristics.

Example: Primate ancestral groups evolving into specific of apes

Indirect Evidence
Often instead of looking at fossils, biologist can look at current species and use other methods to hypothesis their family background. If we assume that adaptation is an inherited trait, then we can look at patterns of inheritance through embryological , structural, physiological or biochemical evidence.

( remember: How many and what are the types of indirect proof ?)

Embryology:
Each organism starts off as a simple cell. If it divides into a multicellular organism the cells divide and create unique structures. An embryo is the prebirth stage of living organism. Embryology is the study of organisms in their earliest stages of development. In the 1800’s it was noted that several organisms show similarities in their embryonic development. This observation brought forth the statement and a theory of recapitulation:

” Ontogeny recapitulates Phylogeny”

In simple terms, each organism shows their evolutionary history ( phylogeny) in its own embryonic development ( ontogeny).

Homologous and Analogous Structures:
Homologous Structures:

Often organisms will have similar structures but these structures serve different functions. This is an example of an indirect proof of divergent evolution. Key thing to remember. Similar structure but different function.

Analogous Structures:

Often organisms will show structures that provide the same function but have differences in structure. Key point, similarity in function but not in structure. This can also be used as indirect proof of divergent evolution.

Vestigial Structures:

Sometimes creatures have structures that serve no apparent function, like hips on snakes or a human appendix. A structure with no apparent function is said to be vestigial.

Physiological Evidence:
Physiology:

How organs within an organism work is the study of physiology. For example observing and learning how organisms excrete waste, would be examining a physiological phenomenon. Tissues and chemical reactions within organs can be regulated by specific

Chapter Three: Mechanisms of Change

Some notes to stimulate your appetite to think about the mechanisms of change and how to prepare for chapter three quiz.
In chapter two, we are introduced to evidence regarding showing change with time. The premise is this, from direct and indirect evidence; there are observations that show a change with time. This process of change with time can be shown in adaptations in populations of organisms. We have noted that this process can be shown using concepts such as speciation and isolation mechanisms. Basically, keep one species away from another and allow mating only to occur within this population, the chances are that a unique species will evolve. In chapter three, we begin to hypothesize about the mechanism that causes this change.

Historical note:

Though some philosophers have suggested that we learn nothing from observing history, the case is not the same for observing fossils. We begin with the notion that all species are fixed. No that does not mean neutered but that all species were put on the earth at a specific time and in a specific place. From a western philosophical point of view, those folks that were busy classifying nature never challenged this idea. Biologists were in fact part of a field of inquiry known as natural history and sometimes grouped with natural philosophers. For many years, “Naturalists” were quite content to just identify and classify and to create some universal means to classify all living things. Then the inquiry into how things worked began. The scientific method created a method of thinking to examine the world. Forces such as gravity and energy became the field of inquiry for scientists. From this inquiry came “laws” and interpretations of chemical and physical forces. As naturalist began to observe more history of organisms upon the earth, the inquiry began to follow the same pattern of questioning. What was going on? Why did organisms become extinct? Why were animals different? Were there unknown forces within nature, like the forces of gravity and Newtonian physics?

So now tracking information within the text. Who started asking questions about the fixity of species and how could this questioning affect how people perceived fossils? Once a question is asked, more will follow. So who proposed the idea of adaptations, the law of use and disuse? Why do you suppose he used a term such as “law”? Let’s make a few observations such as”: a heron has long legs, some insects are resistant to insecticides,and some organisms have thick skin or fur. How could we explain these adaptations from Lamarck and Darwin’s point of view?

Now lets get logical and examine some of the ideas proposed by both Lamarck and Darwin.

Here are some statements, can you identify ones that Darwin would support or Lamarck would support? Which Statements can be used with the other to create an argument?

Many types of variations exist within a species
Members of a species tend to increase in a geometric ration from generation to generation (example 2:4:8:16: 32)
Some variations have more survival value than others
Organisms in a population reproduce, but the population tends to remain constant
There is a struggle for survival
Organisms are able to adapt to their environment when they inherit variations that have been developed by their parents through use and disuse of certain organs
How would Darwin use some of these statements to support his mechanism of change? With both Darwin and Lamarck, we have a key problem to consider does the environment affect how an organism evolves, or does the organism have a means to adapt to the environment. One of the key issues is the notion of choice. If we accept the idea that the environment is selecting species, then does the notion of “free will” and “choice” have a place in human thought? So let’s look outside the realm of the human mind. Organisms on the planet have genetic material. This material allows organisms to display traits. This information, first shown by an inventive monk named Mendel remained unknown to both Lamarck and Darwin. So, while both were looking for a source of change, either within the organism or due to the environment neither of them knew about the origin and transmission of variation.

Darwin did consider domestic animal breeding and noted how humans could artificially select traits, but he still didn’t know about the source of these traits. He did suggest that through artificial breeding of animals, humans could “select” a desirable trait. However he was still in a muddle about the origins of traits or why some organisms produced infertile young. For example, the notion of a “hybrid”…which is a product of a cross of two species and in some cases can be infertile such as a donkey and horse was a mystery to Darwin. Darwin did note the formation of species, and the multiplication of species or speciation. He suggested that this process was gradual with time. Yet the more evidence that was brought forth challenged this portion of his idea. Can you define and show examples of the idea known as “punctuated equilibrium”?

Now here is the challenge…

Darwin suggested that his observations about finches in the Galapagos islands was an example of the process of evolution and that by noting this process, the mechanism for natural selection could be illustrated

…First of all…who offered the idea of a struggle for existence and natural selection to Darwin?

Now by using some of the terminology such as:

Isolation mechanisms

Speciation

Hybrid

Competition

Predators

Can you describe what occurred with the finches and why they changed with time? Remember to break up you explanation into two parts…the observations that showed a process and the concepts that explain the mechanism.