" The Big Picture!" by Mr C

VSB Science Blog

Bio 11 DNA Notes

Structure and Function of DNA

 

What does DNA stand for?

 

What is the function of DNA?

 

 

 

Where is DNA found?

 

 

What is the structure of DNA?

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

What is a nucleotide?

Shat are the 4 bases found in DNA?

 

What is complementary base pairing?

 

 

 

 

 

 

•     DeoxyriboNucleicAcid

 

 

•     provides instructions for

o   the synthesis of enzymes that control cell functioning

o   its own replication (the only molecule known that can replicate itself)

 

 

•     found in all cells of all organisms

•     in eukaryotes it is found only in the nucleus

 

•       two long strands twisted around each other in a shape called a “double helix”

•     when unravelled it looks like a ladder

•     sides of the ladder are alternating sugar and phosphate – the “sugar phosphate backbone”

•     rungs of the ladder arecomplementary pairs of “nitrogenous bases” joined by hydrogen bonds

•     largest humn chromosome has about 250,000,000 base pairs

 

•     DNA molecule made up of many units (like lego blocks) called nucleotides

•     each nucleotide consists of a phosphate molecule + sugar + nitrogenous base

 
•     4 types of bases in DNA

o   adenine (A)

o   cytosine (C)

o   guanine (G)

o   thymine (T)

 

 

 

•     adenine and thymine complement each other and always pair

•     cytosine and guanine complement each other and always pair

 

Genes

What are genes?

 

 

 

 

 

What are enzymes?

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

•       Genes are units of instruction, located on chromosomes, that determine specific traits in an individual.

•       Each gene consist of a length of DNA that contains instructions (the “code”) for making a specific enzyme.

 

 

•       protein molecules that control the chemical reactions in a cell

•       Enzymes are proteins made of long chains of amino acids.

•       there are 20 kinds of amino acids.

 

 

An Analogy:

Think of the nitrogenous bases along a single strand of DNA as being letters:

 

ATGCTCGAATAAATGTGAATTTGA

The letters make words:

 

ATG   CTC   GAA     TAA   ATG   TGA     ATT   TGA
 

The words make sentences:

<ATG     CTC   GAA   TAA     ATG   TGA   ATT     TGA>
These “sentences” are called genes. Each three letter “word” in the sentence is called a codon, and represents a different amino acid. Enzymes are proteins made of long strings of amino acids. Each “sentence” (gene) is the code for an enzyme made up of amino acids.

 

 

 

RNA and Enzyme Assembly

 

What does RNA stand for?

 

What is the function of RNA?

 

 

Where is RNA found?

 

What is the structure of RNA?

 

 

 

what are the 3 kinds of RNA?

 

 

 

How is RNA formed?

 

 

 

 

 

 

 

 

 

 

How are enzymes assembled?

 

 

 

 

•     RiboNucleicAcid

 

 

•     functions as a messenger, carrying instructions from the DNA to the rest of the cell

 

 

•     in the nucleus and in the cytoplasmm

 

 

•     similar to DNA except:

•     only one strand

•     the base thymine is replced with a base called uracil (U)

 

 

1.     messengern RNA (mRNA)

2.    transfer RNA (tRNA)

3.    ribosomal RNA (rRNA)

 

 

RNA formed through a process called transcription

 

1) The hydrogen bonds between complementary bases break.

2) Thedouble helix unravels (becomes untwisted), exposing unpaired bases.

3) New nucleotides, with complementary bases, come and form a new chain along only one strand of the DNA.

4) Chemical bonds form between the sugars and the phosphates of the new nucleotides

 

•     Every time the cell needs a particular enzyme assembled, a new mRNA molecule is created from the gene on the DNA that “codes for” that enzyme

•     the mRNA goes out into the cytoplasm and finds a ribosome, which is an organelle that assembles proteins

•     the ribosome “reads” the mRNA code and uses it to assemble a chain of amino acids that becomes the required enzyme

DNA Replication

 

Why does DNA replicate (reproduce) itself?

 

 

What is the process of DNA replication?

 

DNA replictes so that every time a cell divides, each new daughter cell can have an identical copy of DNA (instructions)

 

 

1)    The hydrogen bonds between complementary bases break

2)    The double helix unravels (becomes untwisted), exposing unpaired bases

3)    New nucleotides, with complementary bases, come and form hydrogen bonds with the unpaired bases, forming a new chain.

4)     Chemical bonds form between the sugars and phosphates of the new nucleotides.

5)    The result is 2 new strands of DNA, each of which has one strand from the original DNA and one strand that is newly created.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
Every once in a while, a mistake happens while DNA is duplicating itself, and the new strand will be slightly different than the original strand. These mistakes are called mutations

posted by Marc Bernard Carmichael in Biology Eleven,Biology Eleven Lesson Outline and have No Comments

No comments

Leave a Reply

Your email address will not be published. Required fields are marked *


*