Biology 11
Name: ____________________ Date: __________ Block: _____
The Basic Structure of DNA
THE STRUCTURE OF DNA (pg 609, 613, 614)
DNA is a type of molecule called a ______________ acid. The basic units or “building blocks” of DNA are called ______________, and are arranged in long chains. Each of these units is made up of three subunits: a _____________, a _____________, and a _____________
A molecule of DNA is actually made up of 2 long molecules (called strands), twisted around each other into a shape called a __________________ . A strand of DNA is made up of many ______________ strung together, like beads on a chain. The alternating ______________ and ______________ are joined by chemical bonds, and form the “spine” or “backbone” of the DNA strand, with the ______________ sticking out the side.
The number of different kinds of nitrogenous bases found in DNA is ____. Below are diagrams of the different bases. Name each base.
______________ ______________
|
______________ ______________
When two strands join together to form a double helix, the ______________ of the nucleotides join together with a chemical bond between them. These bonds are called hydrogen bonds.
Each base will only bond with its complementary base to form a complementary base pair:
– ______________ always bonds with ______________
– ______________ always bonds with ______________
The 2 strands form a ladder shape. The alternating ______________ and ______________ are the sides of the ladder, and the ______________ are the rungs of the ladder. When the ladder is twisted, it forms a ______________ shape.
|
How does DNA duplicate itself?
1) The ______________ between complementary bases break
2) The ______________ unravels (becomes untwisted), exposing unpaired bases
3) New ______________, with complementary bases, come and form ______________ bonds with the unpaired bases, forming a new chain.
4) Chemical bonds form between the ____________ and ____________ of the new nucleotides.
|
|
5) The result is 2 new ______________ of DNA, each of which has one strand from the original DNA and one strand that is newly created.
Every once in a while, a mistake happens while DNA is duplicating itself, and the new strand will be slightly different than the original strand. These mistakes are called _______________.
What are Genes?
(see pg 140) Genes are units of _______________ located on _______________ that produce or influence a specific trait in an individual.
Each gene consist of a length of DNA that contains instructions (the “code”) for making a specific proteins. Proteins are required for the structure, function, and regulation of the body’s cells, tissues, and organs.
Think of the bases along a single strand of DNA as being letters:
ATGCTCGAATAAATGTGAATTTGA
The letters make words:
ATG CTC GAA TAA ATG TGA ATT TGA
The words make sentences:
< ATG CTC GAA TAA ATG TGA ATT TGA>
These “sentences” are called genes. Each “word” in the sentence is called a codon, and codes for a different amino acid. Proteins are made of long strings of amino acids. The sentence as a whole is the code for a protein made up of a chain of amino acids assembled in a specific order.
We have approximately three billion pairs of nitrogenous bases in the DNA in most of our cells. This complete set of genes is called a genome. With the exception of identical twins, the sequence of the bases is different for everyone, which makes each of us unique.
Although we all look quite different from one another, we are surprisingly alike at the DNA level. → the DNA of most people is 99.9 percent the same. And our DNA is 98% the same as a pygmy chimpanzee!!
What is RNA?
DNA doesn’t make proteins directly, instead, the DNA creates another molecule, called RNA, which functions as a messenger, carrying instructions from the DNA to organelles called _______________, that assemble proteins in the cytoplasm.
The nucleotides that make up RNA are very similar to those that make up DNA. However, instead of thymine, the nucleotides of RNA contain a nitrogenous base called uracil.
_______________ is replaced with _______________
How is RNA Formed?
RNA is formed through a process called transcription, and the process is controlled by an enzyme called RNA Polymerase
1) The ______________ bonds between complementary bases break.
2) The ______________ unravels (becomes untwisted), exposing unpaired bases.
3) New ______________, with complementary bases, come and form a new chain.
4) Chemical bonds form between the ____________ and ____________ of the new nucleotides.
5) Note that _______________ do NOT form between the complementary bases.
How are Proteins Assembled?
The RNA moves out of the _______________ into the _______________, where it is used by the organelles called _______________ as a “template” for assembling _______________ into _______________ molecules.
The following chart shows all of the possible codons (formed by combinations of bases), and which amino acid corresponds to each codon:
Use the chart of amino acid codes to determine which amino acids will be formed by the following length of RNA (all that is shown are the bases in the RNA):
ACA – AGA – CGC – UAU – GUA – AAA – CAU – UCG – UGA
No comments