{"id":449,"date":"2016-10-13T21:41:30","date_gmt":"2016-10-13T21:41:30","guid":{"rendered":"http:\/\/blogs.vsb.bc.ca\/mcarmichae\/?p=449"},"modified":"2016-10-13T21:41:30","modified_gmt":"2016-10-13T21:41:30","slug":"bio-11-dna-notes","status":"publish","type":"post","link":"https:\/\/blogs.vsb.bc.ca\/mcarmichae\/2016\/10\/13\/bio-11-dna-notes\/","title":{"rendered":"Bio 11 DNA Notes"},"content":{"rendered":"

Structure and Function of DNA<\/p>\n

 <\/p>\n\n\n\n
What does DNA stand for?<\/p>\n

 <\/p>\n

What is the function of DNA?<\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

Where is DNA found?<\/p>\n

 <\/p>\n

 <\/p>\n

What is the structure of DNA?<\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

What is a nucleotide?<\/p>\n

Shat are the 4 bases found in DNA?<\/p>\n

 <\/p>\n

What is complementary base pairing?<\/td>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0 D<\/u>eoxyriboN<\/u>ucleicA<\/u>cid<\/p>\n

 <\/p>\n

 <\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0 provides instructions for<\/p>\n

o\u00a0\u00a0 the synthesis of enzymes that control cell functioning<\/p>\n

o\u00a0\u00a0 its own replication (the only molecule known that can replicate itself)<\/p>\n

 <\/p>\n

 <\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0 found in all cells of all organisms<\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0 in eukaryotes it is found only in the nucleus<\/p>\n

 <\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0 two long strands twisted around each other in a shape called a “double helix”<\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0 when unravelled it looks like a ladder<\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0 sides of the ladder are alternating sugar and phosphate – the “sugar phosphate backbone”<\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0 rungs of the ladder arecomplementary pairs of “nitrogenous bases” joined by hydrogen bonds<\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0 largest humn chromosome has about 250,000,000 base pairs<\/p>\n

 <\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0 DNA molecule made up of many units (like lego blocks) called nucleotides<\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0 each nucleotide consists of a phosphate molecule + sugar + nitrogenous base<\/p>\n

 
\n\u2022\u00a0\u00a0\u00a0\u00a0 4 types of bases in DNA<\/p>\n

o\u00a0\u00a0 adenine (A)<\/p>\n

o\u00a0\u00a0 cytosine (C)<\/p>\n

o\u00a0\u00a0 guanine (G)<\/p>\n

o\u00a0\u00a0 thymine (T)<\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0 adenine and thymine complement each other and always pair<\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0 cytosine and guanine complement each other and always pair<\/p>\n

 <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

Genes<\/p>\n\n\n\n
What are genes?<\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

What are enzymes?<\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/td>\n

\u2022\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0 Genes are units of instruction, located on chromosomes, that determine specific traits in an individual.<\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0 Each gene consist of a length of DNA that contains instructions (the “code”) for making a specific enzyme.<\/p>\n

 <\/p>\n

 <\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0 protein molecules that control the chemical reactions in a cell<\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0 Enzymes are proteins made of long chains of amino acids.<\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0 there are 20 kinds of amino acids.<\/p>\n

 <\/p>\n

 <\/p>\n

An Analogy:<\/strong><\/p>\n

Think of the nitrogenous bases along a single strand of DNA as being letters:<\/p>\n

 <\/p>\n

ATGCTCGAATAAATGTGAATTTGA<\/p>\n

The letters make words:<\/p>\n

 <\/p>\n

ATG\u00a0\u00a0 CTC\u00a0\u00a0 GAA \u00a0 \u00a0 TAA\u00a0\u00a0 ATG\u00a0\u00a0 TGA \u00a0 \u00a0 ATT\u00a0\u00a0 TGA
\n <\/p>\n

The words make sentences:<\/p>\n

<ATG \u00a0 \u00a0 CTC\u00a0\u00a0 GAA\u00a0\u00a0 TAA \u00a0 \u00a0 ATG\u00a0\u00a0 TGA\u00a0\u00a0 ATT \u00a0 \u00a0 TGA>
\nThese “sentences” are called genes. Each three letter “word” in the sentence is called a codon<\/u>, and represents a different amino acid. Enzymes are proteins made of long strings of amino acids. Each “sentence” (gene) is the code for an enzyme made up of amino acids.<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

\u00a0<\/em><\/p>\n

 <\/p>\n

\u00a0<\/em><\/p>\n

RNA and Enzyme Assembly<\/p>\n

\u00a0<\/em><\/p>\n\n\n\n
What does RNA stand for?<\/p>\n

 <\/p>\n

What is the function of RNA?<\/p>\n

 <\/p>\n

 <\/p>\n

Where is RNA found?<\/p>\n

 <\/p>\n

What is the structure of RNA?<\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

what are the 3 kinds of RNA?<\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

How is RNA formed?<\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

How are enzymes assembled?<\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/td>\n

\u2022\u00a0\u00a0\u00a0\u00a0 R<\/u>iboN<\/u>ucleicA<\/u>cid<\/p>\n

 <\/p>\n

 <\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0 functions as a messenger, carrying instructions from the DNA to the rest of the cell<\/p>\n

 <\/p>\n

 <\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0 in the nucleus and in the cytoplasmm<\/p>\n

 <\/p>\n

 <\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0 similar to DNA except:<\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0 only one strand<\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0 the base thymine is replced with a base called uracil (U)<\/p>\n

 <\/p>\n

 <\/p>\n

1.\u00a0\u00a0\u00a0\u00a0 messengern RNA (mRNA)<\/p>\n

2.\u00a0\u00a0\u00a0 transfer RNA (tRNA)<\/p>\n

3.\u00a0\u00a0\u00a0 ribosomal RNA (rRNA)<\/p>\n

 <\/p>\n

 <\/p>\n

RNA formed through a process called transcription<\/p>\n

 <\/p>\n

1) The hydrogen bonds between complementary bases break.<\/p>\n

2) Thedouble helix unravels (becomes untwisted), exposing unpaired bases.<\/p>\n

3) New nucleotides, with complementary bases, come and form a new chain along only one strand of the DNA.<\/p>\n

4) Chemical bonds form between the sugars and the phosphates of the new nucleotides<\/p>\n

 <\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0 Every time the cell needs a particular enzyme assembled, a new mRNA molecule is created from the gene on the DNA that “codes for” that enzyme<\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0 the mRNA goes out into the cytoplasm and finds a ribosome, which is an organelle that assembles proteins<\/p>\n

\u2022\u00a0\u00a0\u00a0\u00a0 the ribosome “reads” the mRNA code and uses it to assemble a chain of amino acids that becomes the required enzyme<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

DNA Replication<\/p>\n

 <\/p>\n\n\n\n
Why does DNA replicate (reproduce) itself?<\/p>\n

 <\/p>\n

 <\/p>\n

What is the process of DNA replication?<\/p>\n

 <\/td>\n

DNA replictes so that every time a cell divides, each new daughter cell can have an identical copy of DNA (instructions)<\/p>\n

 <\/p>\n

 <\/p>\n

1)\u00a0\u00a0\u00a0 The hydrogen bonds between complementary bases break<\/p>\n

2)\u00a0\u00a0\u00a0 The double helix unravels (becomes untwisted), exposing unpaired bases<\/p>\n

3)\u00a0\u00a0\u00a0 New nucleotides, with complementary bases, come and form hydrogen bonds with the unpaired bases, forming a new chain.<\/p>\n

4)\u00a0\u00a0\u00a0\u00a0 Chemical bonds form between the sugars and phosphates of the new nucleotides.<\/p>\n

5)\u00a0\u00a0\u00a0 The result is 2 new strands of DNA, each of which has one strand from the original DNA and one strand that is newly created.<\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 <\/p>\n

 
\nEvery once in a while, a mistake happens while DNA is duplicating itself, and the new strand will be slightly different than the original strand. These mistakes are called mutations<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n","protected":false},"excerpt":{"rendered":"

Structure and Function of DNA   What does DNA stand for?   What is the function of DNA?       Where is DNA found?     What is the structure of DNA?                                         What is […]<\/p>\n","protected":false},"author":245,"featured_media":0,"comment_status":"open","ping_status":"open","sticky":false,"template":"","format":"standard","meta":{"footnotes":""},"categories":[5,10],"tags":[],"class_list":["post-449","post","type-post","status-publish","format-standard","hentry","category-biology-eleven","category-biology-eleven-lesson-outline"],"_links":{"self":[{"href":"https:\/\/blogs.vsb.bc.ca\/mcarmichae\/wp-json\/wp\/v2\/posts\/449","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/blogs.vsb.bc.ca\/mcarmichae\/wp-json\/wp\/v2\/posts"}],"about":[{"href":"https:\/\/blogs.vsb.bc.ca\/mcarmichae\/wp-json\/wp\/v2\/types\/post"}],"author":[{"embeddable":true,"href":"https:\/\/blogs.vsb.bc.ca\/mcarmichae\/wp-json\/wp\/v2\/users\/245"}],"replies":[{"embeddable":true,"href":"https:\/\/blogs.vsb.bc.ca\/mcarmichae\/wp-json\/wp\/v2\/comments?post=449"}],"version-history":[{"count":1,"href":"https:\/\/blogs.vsb.bc.ca\/mcarmichae\/wp-json\/wp\/v2\/posts\/449\/revisions"}],"predecessor-version":[{"id":450,"href":"https:\/\/blogs.vsb.bc.ca\/mcarmichae\/wp-json\/wp\/v2\/posts\/449\/revisions\/450"}],"wp:attachment":[{"href":"https:\/\/blogs.vsb.bc.ca\/mcarmichae\/wp-json\/wp\/v2\/media?parent=449"}],"wp:term":[{"taxonomy":"category","embeddable":true,"href":"https:\/\/blogs.vsb.bc.ca\/mcarmichae\/wp-json\/wp\/v2\/categories?post=449"},{"taxonomy":"post_tag","embeddable":true,"href":"https:\/\/blogs.vsb.bc.ca\/mcarmichae\/wp-json\/wp\/v2\/tags?post=449"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}